SNP Excel tough one

GreenSlugg

New Member
Joined
Nov 19, 2011
Messages
7
Here is a challenge, that can probably only be solved by an Excel expert. Can this be organized into rows and columns properly? The below data is from 3 SNPs. I have a text document with just over 148,000 of these. I would like the below data to be turned into 3 rows, with as many columns as is necessary for organization. Can this be done?


<ExchangeSet>
<Report>
<Rs rsId="121913193" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050060080001040010100100" taxId="9606">
<Het type="est" value="0.02" stdError="0.1058"/>
<Validation byCluster="true" byFrequency="true" by1000G="true"/>
<Create build="133" date="2010-11-22 14:03"/>
<Update build="134" date="2011-10-06 16:25"/>
<Sequence exemplarSs="275515011" ancestralAllele="C,C">
<Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
<Observed>C/T</Observed>
<Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
</Sequence>
<Ss ssId="275515011" handle="GEH" batchId="1052340" locSnpId="NM_005534.3:c.74-3673C>T" subSnpClass="snp" orient="forward" strand="bottom" molType="genomic" buildId="133" methodClass="sequence" validated="by-submitter">
<Sequence>
<Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
<Observed>C/T</Observed>
<Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
</Sequence>
</Ss>
<Ss ssId="340995776" handle="1000GENOMES" batchId="1056111" locSnpId="20100804_snps_12639317_chr21_34783522" subSnpClass="snp" orient="forward" molType="genomic" buildId="134" methodClass="sequence">
<Sequence>
<Seq5>ATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
<Observed>C/T</Observed>
<Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGT</Seq3>
</Sequence>
</Ss>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
<Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
<MapLoc asnFrom="20445392" asnTo="20445392" locType="exact" alnQuality="1" orient="forward" physMapInt="34783521" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="20445391" rightContigNeighborPos="20445393">
<FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
</MapLoc>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="HuRef" current="true">
<Component componentType="contig" accession="NW_001838706.1" chromosome="21" start="570586" end="24462175" orientation="fwd" gi="157697894" groupTerm="AC_000153.1" contigLabel="GCF_000002125.1">
<MapLoc asnFrom="19681727" asnTo="19681727" locType="exact" alnQuality="1" orient="forward" physMapInt="20252313" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="19681726" rightContigNeighborPos="19681728">
<FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
</MapLoc>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<PrimarySequence dbSnpBuild="135" gi="187423893" source="remap" accession="NG_007570.1">
<MapLoc asnFrom="13320" asnTo="13320" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="13319" rightContigNeighborPos="13321"/>
</PrimarySequence>
<RsLinkout resourceId="1" linkValue="121913193"/>
<hgvs>NC_000021.8:g.34783522C>T</hgvs>
<hgvs>NG_007570.1:g.13321C>T</hgvs>
<hgvs>NM_005534.3:c.74-3673C>T</hgvs>
<Frequency freq="0.0119" allele="T" sampleSize="2188"/>
</Rs>
</Report>

<Report>
<Rs rsId="118191823" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
<Het type="est" value="0.05" stdError="0.1483"/>
<Validation byFrequency="true" by1000G="true"/>
<Create build="132" date="2010-07-15 11:22"/>
<Update build="132" date="2011-09-09 11:56"/>
<Sequence exemplarSs="237932818" ancestralAllele="T,T,T">
<Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
<Observed>C/T</Observed>
<Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
</Sequence>
<Ss ssId="237932818" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7537447_chr21_22395106" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
<Sequence>
<Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
<Observed>C/T</Observed>
<Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
</Sequence>
</Ss>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
<Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
<MapLoc asnFrom="9135105" asnTo="9135105" locType="exact" alnQuality="1" orient="forward" physMapInt="23473234" leftContigNeighborPos="9135104" rightContigNeighborPos="9135106"/>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<RsLinkout resourceId="1" linkValue="118191823"/>
<hgvs>NC_000021.8:g.23473235T>C</hgvs>
<Frequency freq="0.0215" allele="C" sampleSize="2188"/>
</Rs>
</Report>

<Report>
<Rs rsId="118189973" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
<Het type="est" value="0.05" stdError="0.1483"/>
<Validation byFrequency="true" by1000G="true"/>
<Create build="132" date="2010-07-15 11:22"/>
<Update build="132" date="2011-09-09 11:56"/>
<Sequence exemplarSs="237966787" ancestralAllele="T,T,T">
<Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
<Observed>C/T</Observed>
<Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
</Sequence>
<Ss ssId="237966787" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7571416_chr21_33096855" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
<Sequence>
<Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
<Observed>C/T</Observed>
<Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
</Sequence>
</Ss>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
<Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
<MapLoc asnFrom="19836855" asnTo="19836855" locType="exact" alnQuality="1" orient="forward" physMapInt="34174984" leftContigNeighborPos="19836854" rightContigNeighborPos="19836856">
<FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_019596" mrnaVer="5" fxnClass="intron-variant"/>
<FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162495" mrnaVer="2" fxnClass="intron-variant"/>
<FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162496" mrnaVer="2" fxnClass="intron-variant"/>
</MapLoc>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<RsLinkout resourceId="1" linkValue="118189973"/>
<hgvs>NM_001162495.2:c.-65+4967A>G</hgvs>
<hgvs>NM_019596.5:c.-65+7899A>G</hgvs>
<hgvs>NM_001162496.2:c.-64-8189A>G</hgvs>
<hgvs>NC_000021.8:g.34174985T>C</hgvs>
<Frequency freq="0.0133" allele="C" sampleSize="2188"/>
</Rs>
</Report>
 

Some videos you may like

Excel Facts

Back into an answer in Excel
Use Data, What-If Analysis, Goal Seek to find the correct input cell value to reach a desired result

konew1

Well-known Member
Joined
Oct 17, 2007
Messages
2,287
Can you give us a clue as to where you want the column breaks? You gave the source data but haven't clearly stated how you would like the final output to look.
 

GreenSlugg

New Member
Joined
Nov 19, 2011
Messages
7
Can you give us a clue as to where you want the column breaks? You gave the source data but haven't clearly stated how you would like the final output to look.

I am sorry. This did not even copy and paste right. I thank you for your reply. I want to learn how to program myself also.

...

Can I change my request to something else entirely? I should learn how to program this myself. I need to learn how to learn "vba". I have never done any programming before, except to modify other people's programs. Can you point me in the right direction?

The problem that I have is that I have a series of very large text files that cannot even be opened by themselves because of their large size. I can open them in Excel as long as I use about 8 spreadsheets. I need to learn how to break up paragraphs of data into columns for myself.

An example is that within the paragraph there will be something like rs239045892389 and also freq=.432 (I made that exact example up by the way). I want rs values to go into one column, and frequency values to go into another column altogether. There are also about 20 other values that I would like to go into their own columns. A third column would be something like "G/C".

Unfortunately this is not as simple as taking rows 3,13,23,33 etc. and going with that. Frequency values are inconsistent spaces apart, for example.

I really appreciate you taking the time out of your day for me. I have not googled vba tutorials for Excel yet.
 

Norie

Well-known Member
Joined
Apr 28, 2004
Messages
76,219
Office Version
  1. 365
Platform
  1. Windows
Perhaps Excel isn't the right tool to use if you can only open the data across 8 workboooks/worksheets.

It's probably possible to do what you want using Excel but having so much data does make things a little harder.

You do really give us some more information.

For example, how to you know where the 'breaks' are?

Is there some identifying feature that can be used to recognise the beginning and end of an SNP?

What's an SNP anyway?:)
 

GreenSlugg

New Member
Joined
Nov 19, 2011
Messages
7

ADVERTISEMENT

Let me start by answering your question on what an "SNP" is. SNP stands for "single nucleotide polymorphism". A nucleotide is a "letter" in your genetic code, A,C,G, or T. Single, of course means "one" because this term refers to "one" letter in the code, as opposed to two or more letters. If we have a particular SNP, some people might have an A, while others have a T, or some people might have a G while others have an A in a particular location. Polymorphism, just means that the minority version occurs with a frequency of greater than 1% in a population.

Where the data says <Report> should be either the beginning or the end of a new row. The rest should be broken up into columns. Is there any way to do this? Like I said, I should learn how to do this myself. (Hopefully the data has copy/ pasted correctly this time). What you see here should be three SNPs that should be in three rows.


<ExchangeSet>
<Report>
<Rs rsId="121913193" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050060080001040010100100" taxId="9606">
<Het type="est" value="0.02" stdError="0.1058"/>
<Validation byCluster="true" byFrequency="true" by1000G="true"/>
<Create build="133" date="2010-11-22 14:03"/>
<Update build="134" date="2011-10-06 16:25"/>
<Sequence exemplarSs="275515011" ancestralAllele="C,C">
<Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
<Observed>C/T</Observed>
<Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
</Sequence>
<Ss ssId="275515011" handle="GEH" batchId="1052340" locSnpId="NM_005534.3:c.74-3673C>T" subSnpClass="snp" orient="forward" strand="bottom" molType="genomic" buildId="133" methodClass="sequence" validated="by-submitter">
<Sequence>
<Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
<Observed>C/T</Observed>
<Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
</Sequence>
</Ss>
<Ss ssId="340995776" handle="1000GENOMES" batchId="1056111" locSnpId="20100804_snps_12639317_chr21_34783522" subSnpClass="snp" orient="forward" molType="genomic" buildId="134" methodClass="sequence">
<Sequence>
<Seq5>ATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
<Observed>C/T</Observed>
<Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGT</Seq3>
</Sequence>
</Ss>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
<Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
<MapLoc asnFrom="20445392" asnTo="20445392" locType="exact" alnQuality="1" orient="forward" physMapInt="34783521" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="20445391" rightContigNeighborPos="20445393">
<FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
</MapLoc>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="HuRef" current="true">
<Component componentType="contig" accession="NW_001838706.1" chromosome="21" start="570586" end="24462175" orientation="fwd" gi="157697894" groupTerm="AC_000153.1" contigLabel="GCF_000002125.1">
<MapLoc asnFrom="19681727" asnTo="19681727" locType="exact" alnQuality="1" orient="forward" physMapInt="20252313" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="19681726" rightContigNeighborPos="19681728">
<FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
</MapLoc>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<PrimarySequence dbSnpBuild="135" gi="187423893" source="remap" accession="NG_007570.1">
<MapLoc asnFrom="13320" asnTo="13320" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="13319" rightContigNeighborPos="13321"/>
</PrimarySequence>
<RsLinkout resourceId="1" linkValue="121913193"/>
<hgvs>NC_000021.8:g.34783522C>T</hgvs>
<hgvs>NG_007570.1:g.13321C>T</hgvs>
<hgvs>NM_005534.3:c.74-3673C>T</hgvs>
<Frequency freq="0.0119" allele="T" sampleSize="2188"/>
</Rs>
</Report>

<Report>
<Rs rsId="118191823" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
<Het type="est" value="0.05" stdError="0.1483"/>
<Validation byFrequency="true" by1000G="true"/>
<Create build="132" date="2010-07-15 11:22"/>
<Update build="132" date="2011-09-09 11:56"/>
<Sequence exemplarSs="237932818" ancestralAllele="T,T,T">
<Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
<Observed>C/T</Observed>
<Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
</Sequence>
<Ss ssId="237932818" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7537447_chr21_22395106" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
<Sequence>
<Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
<Observed>C/T</Observed>
<Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
</Sequence>
</Ss>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
<Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
<MapLoc asnFrom="9135105" asnTo="9135105" locType="exact" alnQuality="1" orient="forward" physMapInt="23473234" leftContigNeighborPos="9135104" rightContigNeighborPos="9135106"/>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<RsLinkout resourceId="1" linkValue="118191823"/>
<hgvs>NC_000021.8:g.23473235T>C</hgvs>
<Frequency freq="0.0215" allele="C" sampleSize="2188"/>
</Rs>
</Report>

<Report>
<Rs rsId="118189973" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
<Het type="est" value="0.05" stdError="0.1483"/>
<Validation byFrequency="true" by1000G="true"/>
<Create build="132" date="2010-07-15 11:22"/>
<Update build="132" date="2011-09-09 11:56"/>
<Sequence exemplarSs="237966787" ancestralAllele="T,T,T">
<Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
<Observed>C/T</Observed>
<Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
</Sequence>
<Ss ssId="237966787" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7571416_chr21_33096855" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
<Sequence>
<Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
<Observed>C/T</Observed>
<Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
</Sequence>
</Ss>
<Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
<Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
<MapLoc asnFrom="19836855" asnTo="19836855" locType="exact" alnQuality="1" orient="forward" physMapInt="34174984" leftContigNeighborPos="19836854" rightContigNeighborPos="19836856">
<FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_019596" mrnaVer="5" fxnClass="intron-variant"/>
<FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162495" mrnaVer="2" fxnClass="intron-variant"/>
<FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162496" mrnaVer="2" fxnClass="intron-variant"/>
</MapLoc>
</Component>
<SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
</Assembly>
<RsLinkout resourceId="1" linkValue="118189973"/>
<hgvs>NM_001162495.2:c.-65+4967A>G</hgvs>
<hgvs>NM_019596.5:c.-65+7899A>G</hgvs>
<hgvs>NM_001162496.2:c.-64-8189A>G</hgvs>
<hgvs>NC_000021.8:g.34174985T>C</hgvs>
<Frequency freq="0.0133" allele="C" sampleSize="2188"/>
</Rs>
</Report>
 

GreenSlugg

New Member
Joined
Nov 19, 2011
Messages
7
Let me try this again.


Code:
<ExchangeSet>
<Report>
    <Rs rsId="121913193" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050060080001040010100100" taxId="9606">
        <Het type="est" value="0.02" stdError="0.1058"/>
        <Validation byCluster="true" byFrequency="true" by1000G="true"/>
        <Create build="133" date="2010-11-22 14:03"/>
        <Update build="134" date="2011-10-06 16:25"/>
        <Sequence exemplarSs="275515011" ancestralAllele="C,C">
            <Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
        </Sequence>
        <Ss ssId="275515011" handle="GEH" batchId="1052340" locSnpId="NM_005534.3:c.74-3673C>T" subSnpClass="snp" orient="forward" strand="bottom" molType="genomic" buildId="133" methodClass="sequence" validated="by-submitter">
            <Sequence>
                <Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
            </Sequence>
        </Ss>
        <Ss ssId="340995776" handle="1000GENOMES" batchId="1056111" locSnpId="20100804_snps_12639317_chr21_34783522" subSnpClass="snp" orient="forward" molType="genomic" buildId="134" methodClass="sequence">
            <Sequence>
                <Seq5>ATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGT</Seq3>
            </Sequence>
        </Ss>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
            <Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
                <MapLoc asnFrom="20445392" asnTo="20445392" locType="exact" alnQuality="1" orient="forward" physMapInt="34783521" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="20445391" rightContigNeighborPos="20445393">
                    <FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
                </MapLoc>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="HuRef" current="true">
            <Component componentType="contig" accession="NW_001838706.1" chromosome="21" start="570586" end="24462175" orientation="fwd" gi="157697894" groupTerm="AC_000153.1" contigLabel="GCF_000002125.1">
                <MapLoc asnFrom="19681727" asnTo="19681727" locType="exact" alnQuality="1" orient="forward" physMapInt="20252313" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="19681726" rightContigNeighborPos="19681728">
                    <FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
                </MapLoc>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <PrimarySequence dbSnpBuild="135" gi="187423893" source="remap" accession="NG_007570.1">
            <MapLoc asnFrom="13320" asnTo="13320" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="13319" rightContigNeighborPos="13321"/>
        </PrimarySequence>
        <RsLinkout resourceId="1" linkValue="121913193"/>
        <hgvs>NC_000021.8:g.34783522C>T</hgvs>
        <hgvs>NG_007570.1:g.13321C>T</hgvs>
        <hgvs>NM_005534.3:c.74-3673C>T</hgvs>
        <Frequency freq="0.0119" allele="T" sampleSize="2188"/>
    </Rs>
</Report>

<Report>
    <Rs rsId="118191823" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
        <Het type="est" value="0.05" stdError="0.1483"/>
        <Validation byFrequency="true" by1000G="true"/>
        <Create build="132" date="2010-07-15 11:22"/>
        <Update build="132" date="2011-09-09 11:56"/>
        <Sequence exemplarSs="237932818" ancestralAllele="T,T,T">
            <Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
        </Sequence>
        <Ss ssId="237932818" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7537447_chr21_22395106" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
            <Sequence>
                <Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
            </Sequence>
        </Ss>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
            <Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
                <MapLoc asnFrom="9135105" asnTo="9135105" locType="exact" alnQuality="1" orient="forward" physMapInt="23473234" leftContigNeighborPos="9135104" rightContigNeighborPos="9135106"/>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <RsLinkout resourceId="1" linkValue="118191823"/>
        <hgvs>NC_000021.8:g.23473235T>C</hgvs>
        <Frequency freq="0.0215" allele="C" sampleSize="2188"/>
    </Rs>
</Report>

<Report>
    <Rs rsId="118189973" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
        <Het type="est" value="0.05" stdError="0.1483"/>
        <Validation byFrequency="true" by1000G="true"/>
        <Create build="132" date="2010-07-15 11:22"/>
        <Update build="132" date="2011-09-09 11:56"/>
        <Sequence exemplarSs="237966787" ancestralAllele="T,T,T">
            <Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
        </Sequence>
        <Ss ssId="237966787" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7571416_chr21_33096855" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
            <Sequence>
                <Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
            </Sequence>
        </Ss>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
            <Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
                <MapLoc asnFrom="19836855" asnTo="19836855" locType="exact" alnQuality="1" orient="forward" physMapInt="34174984" leftContigNeighborPos="19836854" rightContigNeighborPos="19836856">
                    <FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_019596" mrnaVer="5" fxnClass="intron-variant"/>
                    <FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162495" mrnaVer="2" fxnClass="intron-variant"/>
                    <FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162496" mrnaVer="2" fxnClass="intron-variant"/>
                </MapLoc>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <RsLinkout resourceId="1" linkValue="118189973"/>
        <hgvs>NM_001162495.2:c.-65+4967A>G</hgvs>
        <hgvs>NM_019596.5:c.-65+7899A>G</hgvs>
        <hgvs>NM_001162496.2:c.-64-8189A>G</hgvs>
        <hgvs>NC_000021.8:g.34174985T>C</hgvs>
        <Frequency freq="0.0133" allele="C" sampleSize="2188"/>
    </Rs>
</Report>
 

GreenSlugg

New Member
Joined
Nov 19, 2011
Messages
7

ADVERTISEMENT

Finally. Sorry about that.

HTML:
<ExchangeSet>
<Report>
    <Rs rsId="121913193" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050060080001040010100100" taxId="9606">
        <Het type="est" value="0.02" stdError="0.1058"/>
        <Validation byCluster="true" byFrequency="true" by1000G="true"/>
        <Create build="133" date="2010-11-22 14:03"/>
        <Update build="134" date="2011-10-06 16:25"/>
        <Sequence exemplarSs="275515011" ancestralAllele="C,C">
            <Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
        </Sequence>
        <Ss ssId="275515011" handle="GEH" batchId="1052340" locSnpId="NM_005534.3:c.74-3673C>T" subSnpClass="snp" orient="forward" strand="bottom" molType="genomic" buildId="133" methodClass="sequence" validated="by-submitter">
            <Sequence>
                <Seq5>TCCAGCCCTGGTGTTTCCCATCGGGGGCCATGTGGCCTGGAACACAGAGGCTGGGCTGCCCAAGGACAGGCCCCCTGGCCTACAAAAAGGACAGTCTTATCACAGATGTGCAATCCTTGGCACTTCCCTGTGGCGTCTGCAGTTCTGAGACTGATTTTCTTCTATAAATGTGAAAAGATAGGGGATGATAGGAAACCCGGATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGTGATGCCCTTTTGCTGTTCCACGCGTCGCTTGGGGTGGAAGCCCTTCCTTGTCCCCTCGCCACCCACCCCGGAGCCCCTTGGTGCTTCCTTTCTGAACTGAATGCTTAGACTGGGGAACTAGAGGTGCCCGGAAAGGGAAGTCGGGAAGAAGAGACTATTCCTGTTGGTTCCTCCCCAGAGATGGGAGATGGTGAACAGGC</Seq3>
            </Sequence>
        </Ss>
        <Ss ssId="340995776" handle="1000GENOMES" batchId="1056111" locSnpId="20100804_snps_12639317_chr21_34783522" subSnpClass="snp" orient="forward" molType="genomic" buildId="134" methodClass="sequence">
            <Sequence>
                <Seq5>ATATAAGGCAGAACAATGTTGCTTGGGCCATCTCTTACACCTCAGTGAAA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>GGAAAATGAAGGAAATGGAAGGCTGGCATGGGAACCCCGACTTATACAGT</Seq3>
            </Sequence>
        </Ss>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
            <Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
                <MapLoc asnFrom="20445392" asnTo="20445392" locType="exact" alnQuality="1" orient="forward" physMapInt="34783521" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="20445391" rightContigNeighborPos="20445393">
                    <FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
                </MapLoc>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="HuRef" current="true">
            <Component componentType="contig" accession="NW_001838706.1" chromosome="21" start="570586" end="24462175" orientation="fwd" gi="157697894" groupTerm="AC_000153.1" contigLabel="GCF_000002125.1">
                <MapLoc asnFrom="19681727" asnTo="19681727" locType="exact" alnQuality="1" orient="forward" physMapInt="20252313" leftFlankNeighborPos="0" rightFlankNeighborPos="0" leftContigNeighborPos="19681726" rightContigNeighborPos="19681728">
                    <FxnSet geneId="3460" symbol="IFNGR2" mrnaAcc="NM_005534" mrnaVer="3" fxnClass="intron-variant"/>
                </MapLoc>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <PrimarySequence dbSnpBuild="135" gi="187423893" source="remap" accession="NG_007570.1">
            <MapLoc asnFrom="13320" asnTo="13320" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="13319" rightContigNeighborPos="13321"/>
        </PrimarySequence>
        <RsLinkout resourceId="1" linkValue="121913193"/>
        <hgvs>NC_000021.8:g.34783522C>T</hgvs>
        <hgvs>NG_007570.1:g.13321C>T</hgvs>
        <hgvs>NM_005534.3:c.74-3673C>T</hgvs>
        <Frequency freq="0.0119" allele="T" sampleSize="2188"/>
    </Rs>
</Report>

<Report>
    <Rs rsId="118191823" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
        <Het type="est" value="0.05" stdError="0.1483"/>
        <Validation byFrequency="true" by1000G="true"/>
        <Create build="132" date="2010-07-15 11:22"/>
        <Update build="132" date="2011-09-09 11:56"/>
        <Sequence exemplarSs="237932818" ancestralAllele="T,T,T">
            <Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
        </Sequence>
        <Ss ssId="237932818" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7537447_chr21_22395106" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
            <Sequence>
                <Seq5>TAGAAGTGTTCATTAAAAGAAAAAGTTACAGAATCATATACTTGAGACATTTTTGGAAAAATAATATATAAGCATAAGTTGTCTTTTGCCTATTTATTAAAGCCATTCTAGTGTTTGAGAAGTGGTGTTTCTTGTTTTCATGTGCATTTTCATAGTGGATAGTGATGTTGGGCATTTTTTATATGATTATTAGCCATATA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>AATTCTTCTTTGAAGAAAGAGCTATTCAAATCCACTATACTTTTTGATTTATTTTCTTTTACTTTTTTTTAATTGGGGATTTTCTATTCATGTTATGATTTGAAATCATTCAGGACTTTGTTTCTTTTGATGCTTATAATTCTTTAACCATTTCAGAACTGACTGATGCATTTATAATGCTACAACAGAATCTTATTAGG</Seq3>
            </Sequence>
        </Ss>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
            <Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
                <MapLoc asnFrom="9135105" asnTo="9135105" locType="exact" alnQuality="1" orient="forward" physMapInt="23473234" leftContigNeighborPos="9135104" rightContigNeighborPos="9135106"/>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <RsLinkout resourceId="1" linkValue="118191823"/>
        <hgvs>NC_000021.8:g.23473235T>C</hgvs>
        <Frequency freq="0.0215" allele="C" sampleSize="2188"/>
    </Rs>
</Report>

<Report>
    <Rs rsId="118189973" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050000000004040000100100" taxId="9606">
        <Het type="est" value="0.05" stdError="0.1483"/>
        <Validation byFrequency="true" by1000G="true"/>
        <Create build="132" date="2010-07-15 11:22"/>
        <Update build="132" date="2011-09-09 11:56"/>
        <Sequence exemplarSs="237966787" ancestralAllele="T,T,T">
            <Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
        </Sequence>
        <Ss ssId="237966787" handle="1000GENOMES" batchId="1056111" locSnpId="pilot_1_CEU_7571416_chr21_33096855" subSnpClass="snp" orient="forward" molType="genomic" buildId="132" methodClass="sequence">
            <Sequence>
                <Seq5>AACCTAGGTTGCCAGGGAGAGACTGAATCTGGGGAGAAAACACTAGTCAGGACAGTGAATTCTAAATAGTTTTCTTTTGTATTTTCCTCAGTGATTTCCATCTCTCCATTTGTTGACTCCTTCTAACTCCAGGCTCTTTGGATAAATTTGTTTCAATATCTGGAATCCTCAAGGGGATGGAGAGAACCAAGAATGTAGGA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>TGAGAAGGTGGGGATGAGGATGAGGCTGTCTTCCTCCTATGAGCATGAGTCAGGATACCTGCTAGAACCTCCAGGAGGGAACCAGTGGTACAGGGAGCAGGAGAGCCCAGTGGGCAGCACAGCAAAGCATTTGTCTCTCTCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAACCTCCCACTCCTA</Seq3>
            </Sequence>
        </Ss>
        <Assembly dbSnpBuild="135" genomeBuild="37_3" groupLabel="GRCh37.p5" current="true" reference="true">
            <Component componentType="contig" accession="NT_011512.11" chromosome="21" start="14338129" end="42955558" orientation="fwd" gi="224514633" groupTerm="NC_000021.8" contigLabel="GCF_000001405.17">
                <MapLoc asnFrom="19836855" asnTo="19836855" locType="exact" alnQuality="1" orient="forward" physMapInt="34174984" leftContigNeighborPos="19836854" rightContigNeighborPos="19836856">
                    <FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_019596" mrnaVer="5" fxnClass="intron-variant"/>
                    <FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162495" mrnaVer="2" fxnClass="intron-variant"/>
                    <FxnSet geneId="56245" symbol="C21orf62" mrnaAcc="NM_001162496" mrnaVer="2" fxnClass="intron-variant"/>
                </MapLoc>
            </Component>
            <SnpStat mapWeight="unique-in-contig" chromCount="1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/>
        </Assembly>
        <RsLinkout resourceId="1" linkValue="118189973"/>
        <hgvs>NM_001162495.2:c.-65+4967A>G</hgvs>
        <hgvs>NM_019596.5:c.-65+7899A>G</hgvs>
        <hgvs>NM_001162496.2:c.-64-8189A>G</hgvs>
        <hgvs>NC_000021.8:g.34174985T>C</hgvs>
        <Frequency freq="0.0133" allele="C" sampleSize="2188"/>
    </Rs>
</Report>
 

Norie

Well-known Member
Joined
Apr 28, 2004
Messages
76,219
Office Version
  1. 365
Platform
  1. Windows
That looks like XML data to me.

Do you have any related files?

For example a schema file, which should have an XSD schema.

If you have you maybe able to import it directly into Excel.
 

GreenSlugg

New Member
Joined
Nov 19, 2011
Messages
7
That looks like XML data to me.

Do you have any related files?

For example a schema file, which should have an XSD schema.

If you have you maybe able to import it directly into Excel.


It is in an XML format. It is not an XML filetype though. It is in XML format, just like you saw in my thread, but when I download it it is saved as a text document. Would a schema work for this, and if so, then which one would you most recommend?
 

Norie

Well-known Member
Joined
Apr 28, 2004
Messages
76,219
Office Version
  1. 365
Platform
  1. Windows
I was able to open it without a schema both in Excel and another application.

It kind of worked but the structure was obviously not quite right and something, eg the schema, was missing.

As to what to use for a schema, I don't know.

You could try making a copy, renaming with the xml extension and opening it in Excel.

I'm not sure if that can be done in earlier versions though.
 

Watch MrExcel Video

Forum statistics

Threads
1,122,961
Messages
5,599,061
Members
414,281
Latest member
Engjamal2021

We've detected that you are using an adblocker.

We have a great community of people providing Excel help here, but the hosting costs are enormous. You can help keep this site running by allowing ads on MrExcel.com.
Allow Ads at MrExcel

Which adblocker are you using?

Disable AdBlock

Follow these easy steps to disable AdBlock

1)Click on the icon in the browser’s toolbar.
2)Click on the icon in the browser’s toolbar.
2)Click on the "Pause on this site" option.
Go back

Disable AdBlock Plus

Follow these easy steps to disable AdBlock Plus

1)Click on the icon in the browser’s toolbar.
2)Click on the toggle to disable it for "mrexcel.com".
Go back

Disable uBlock Origin

Follow these easy steps to disable uBlock Origin

1)Click on the icon in the browser’s toolbar.
2)Click on the "Power" button.
3)Click on the "Refresh" button.
Go back

Disable uBlock

Follow these easy steps to disable uBlock

1)Click on the icon in the browser’s toolbar.
2)Click on the "Power" button.
3)Click on the "Refresh" button.
Go back
Top